18/3/15

Flamante heredera

Hace ya unos días que se instaló en casa mi más preciada herencia ¡qué ganas tenía de verla aquí! Recordaba perfectamente dónde vivía: detrás de una de las puertas del mismo mueble de comedor en cuya repisa hubo durante toda mi infancia un bote con caramelos. Llegar, saludar, compartir aquel primer rato con los abuelos, y a la primera ocasión escabullirse al comedor y meter la mano en aquel bote. Un ritual. Pues allí, cerca del bote, estaba ella



Claro que a veces salía y la ponían a trabajar, en la cocina. Y yo miraba aquel pedal en movimiento tacatacatacatacatá, y aquella correa que no podía evitar intentar rozar con el dedo.

No recordaba los detalles, así que voy descubriéndolos ahora, poco a poco. Como esa luz incorporada, modernidades dentro de lo antiguo



El cajón extralargo, con su llave extrasimple... y un montón de hebillas dentro! ¿y ahora qué? ¿tendré que ponerme a hacer cinturones como una chiflada?



O la cajita de lata con los accesorios...



... y las instrucciones. Sí, están ahí las instrucciones y todo ¡increíble!



Esa aceitera... ¡me parece una maravilla!



Un montón de accesorios y detalles útiles: rosca para coser o bordar, botón de puntada hacia atrás, prensatelas con guía para coser equidistante... ¡y nada de made in nosedónde!



¿Y la maniobra para dejarla recogida? ¿no es genial?



Y esa extensión de mesa que no puedo tener siempre colocada porque tampoco es cuestión de que Lía se abra la crisma intentando cogerla... ¡pero ahí está para cuando haga falta!



Me parece una delicia comprobar cómo cada detalle está pensado... todo tiene su razón de ser... ¡y da gusto lo bien que cose!

Y ahora, basta de palabrería. Es hora de tacatacatacatacatacatacatacatacatacatacatacatacatá... ¡que además cosiendo con esta máquina se hace ejercicio de pierna al mismo tiempo! Otro día os enseño la primera costura completa que hice con ella...





13 comentarios:

  1. Qué preciosidad!!! Me encanta!!! Y yo que tengo mi herencia en casa de mi madre... no me cabe por ningún sitio!!! Qué ganas tengo de hacerle un huequito y tenerla a mi lado!

    ResponderEliminar
  2. Anónimo18/3/15 9:36

    que recuerdos tan bonitos! y que preciosidad de máquina! yo acabo de heredar también una refrey y me da hasta respeto tocarla... además de que he de aprender para que sirven el sinfín de accesorios que trae! y también lleva el libro de instrucciones, que son de 1974 (increíble, yo hace tiempo que perdí el de la mía y lo tengo bajado en pdf de internet) felicidades por este tesoro seguro que la disfrutas! :)

    ResponderEliminar
  3. Se parece a mi alfa heredada también. En casa de mi abuela materna había de estas máquinas maravillosas con mueble maravilloso, una de ellas ya de mi bisabuela, ¡ahí es nada! y también estaba detrás de la puerta del comedor de dentro... Buff, me acabas de despertar recuerdos maravillosos empañados de lágrimas...

    ResponderEliminar
  4. Que bonito. Mi abuela también tenía una maquina (no de Sigma, ni de Alfa, no sé de que marca era) y me acuerdo que subimos muchas veces para jugar con el pedal... Ahora tengo un Singer en casa pero no se aprecia muy bien porque yo tampoco encuentro rincon para ponerlo... Algún día...

    ResponderEliminar
  5. Que chula. Hace años intentaron enseñarme a coser con el pedal...ná...un desastre, demasiada coordinación! Pero q guay saber q incluso en medio de un temporal y sin luz...puedes seguir cosiendo

    ResponderEliminar
  6. Este comentario ha sido eliminado por el autor.

    ResponderEliminar
  7. Esa sí que es una herencia. Yo tengo dos esperando, pero de esas negras con una pila de años, aún funcionando las dos en casa de mi madre (que también las heredó). Yo no sé si tengo tanta coordinación ojo pie, para ser capaz de coser con el pedal

    ResponderEliminar
  8. Aunque la de mi abuela era Alfa, acabas de traerme un montón de recuerdos. La cajita, la aceitera, el manual...

    ResponderEliminar
  9. Sin palabras. Es preciosa

    ResponderEliminar
  10. Sin palabras. Es preciosa

    ResponderEliminar
  11. Que bonita!!!!!! Una herencia maravillosa

    ResponderEliminar
  12. Eso vale su peso en oro. .... Es una herencia fantástica, llena de recuerdos

    ResponderEliminar
  13. Enhorabuena por tener un padre manitas que arregla lo que sea! Porque cuando salió de su armario después de tantos años, la máquina no hacía TACATACATÁ, hacía gñiiiikkkjjjjjkk-k-k.. Y no había pierna que la arrancase. Me alegro de que la hayas adoptado, obligando ese paso por boxes, es una pasada de aparato y no se merecía acabar en otras manos!

    ResponderEliminar

Di algo, no te cortes... ¡que estamos en confianza!

Related Posts Plugin for WordPress, Blogger...